View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0374_high_22 (Length: 266)
Name: NF0374_high_22
Description: NF0374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0374_high_22 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 4e-87; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 31 - 261
Target Start/End: Original strand, 28861438 - 28861673
Alignment:
| Q |
31 |
ggatatcgagaaattcatcggagaaaatgattttaggttgtggaaggtgaaaatccaagtagtcttaatccagcaaaaagtttgcaaaagtactgaagga |
130 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||| ||| |||||||||||||| ||||| |||||||| ||||||||||| ||||| |
|
|
| T |
28861438 |
ggatatcgagatattcatcggagaaaatgattttaggttgtggaaggagaatatccaagtagtcttgatccaacaaaaagtatgcaaaagtaccgaaggg |
28861537 |
T |
 |
| Q |
131 |
tgaggtagtgttatcggctaccatgtcgcaagaaaacaagactgatatggtggacaaggtcaagagtgtc-ttatgttgtgtctcaaatttaaattgttt |
229 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28861538 |
tgaggtagtgttgtcggctaccatgttgcaagaaaacaagaccgatatggtggacaaggtcaagggtgtcattatgttgtgtctcaaatttaaattgttt |
28861637 |
T |
 |
| Q |
230 |
agc----aagttgcaaaggtgaaggtcgtgtctgtg |
261 |
Q |
| |
|
||| ||||||||||||||||||||||||||||| |
|
|
| T |
28861638 |
agcaagaaagttgcaaaggtgaaggtcgtgtctgtg |
28861673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 31 - 109
Target Start/End: Original strand, 16602084 - 16602162
Alignment:
| Q |
31 |
ggatatcgagaaattcatcggagaaaatgattttaggttgtggaaggtgaaaatccaagtagtcttaatccagcaaaaa |
109 |
Q |
| |
|
||||||||| |||||||||||||| | |||||| |||| |||||||||||||| |||| ||||| || || |||||| |
|
|
| T |
16602084 |
ggatatcgaaaaattcatcggagacagtgatttcgggttatggaaggtgaaaattgaagttgtcttgattcaacaaaaa |
16602162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 31 - 99
Target Start/End: Original strand, 9066082 - 9066150
Alignment:
| Q |
31 |
ggatatcgagaaattcatcggagaaaatgattttaggttgtggaaggtgaaaatccaagtagtcttaat |
99 |
Q |
| |
|
||||||||| ||||||| |||||| || ||||| |||||||||||||||| || |||| | ||||||| |
|
|
| T |
9066082 |
ggatatcgataaattcaccggagacaacgatttctggttgtggaaggtgaatatgcaagcaatcttaat |
9066150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University