View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0374_low_16 (Length: 345)
Name: NF0374_low_16
Description: NF0374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0374_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 37; Significance: 0.000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 107 - 165
Target Start/End: Complemental strand, 4094669 - 4094614
Alignment:
| Q |
107 |
ctagttctgttttattatcatcttttgaacgttgtggaaatataatatcaccctcgttc |
165 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
4094669 |
ctagttctgttttattatc---ttttgaacgttgttgaaatataatataaccctcgttc |
4094614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1617 times since January 2019
Visitors: 3090