View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0374_low_22 (Length: 308)
Name: NF0374_low_22
Description: NF0374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0374_low_22 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 169 - 308
Target Start/End: Original strand, 26998071 - 26998210
Alignment:
| Q |
169 |
atatatattactctctcattctcatatgaggcaattgtctaattttagcatgtgattatctcatcatcaaatgacttgtcaatttgattattattcacat |
268 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26998071 |
atatatattactctctcattctaatatgaggcaattgtctaattttaacatgtgattatctcatcatcaaatgacttgtcaatttgattattattcacat |
26998170 |
T |
|
| Q |
269 |
ctaagtctcggtcccattcatatctagaaaaggaaataat |
308 |
Q |
| |
|
||||||||| | ||||||||||||||||||||||||||| |
|
|
| T |
26998171 |
ctaagtctcccttccattcatatctagaaaaggaaataat |
26998210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1521 times since January 2019
Visitors: 3089