View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0374_low_25 (Length: 292)
Name: NF0374_low_25
Description: NF0374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0374_low_25 |
 |  |
|
[»] scaffold0103 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 62 - 270
Target Start/End: Complemental strand, 22412129 - 22411909
Alignment:
Q |
62 |
gacatcatcataatgtttgagatataaactaactaggttgcttaacaatattcttactaagcaattaatcaagaacaaaacatcaacct----------- |
150 |
Q |
|
|
|||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
22412129 |
gacatcatcataatatttgagatataaactaactagggtgcttaacaatattcttactaagcaattaatcaagaacaaaacatcaacctaacaaacatca |
22412030 |
T |
 |
Q |
151 |
-caaaacttaaactaataaactaaaggagcaactgcattcatctccccaacatgaagatggaagttgtaggtcttcttacaccacctctctgataatgcg |
249 |
Q |
|
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
T |
22412029 |
tcaaaacttaaactaataaactaaaggagcaactacattcatctccccaacatgaagatggaagttgttggtcttcttacgccacctctctgataatgcg |
22411930 |
T |
 |
Q |
250 |
gaaaacatggcattgatgatg |
270 |
Q |
|
|
|||||||||||| |||||||| |
|
|
T |
22411929 |
gaaaacatggcactgatgatg |
22411909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0103 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0103
Description:
Target: scaffold0103; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 188 - 238
Target Start/End: Complemental strand, 14438 - 14388
Alignment:
Q |
188 |
tcatctccccaacatgaagatggaagttgtaggtcttcttacaccacctct |
238 |
Q |
|
|
|||||||||||||||| ||||||||||||| ||||| |||| |||||||| |
|
|
T |
14438 |
tcatctccccaacatgtagatggaagttgttggtctccttatgccacctct |
14388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University