View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0374_low_26 (Length: 292)
Name: NF0374_low_26
Description: NF0374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0374_low_26 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 138; Significance: 4e-72; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 138; E-Value: 4e-72
Query Start/End: Original strand, 75 - 229
Target Start/End: Complemental strand, 45018653 - 45018503
Alignment:
| Q |
75 |
tggtggtggctagctttgacagaccattttcttacatgtctcattgcatatgcatcctcccttcttgcatagggccttatatatagtccatgacatgttt |
174 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
45018653 |
tggtggtggctagctttgacagaccattttcttacatgtctcattgcatatgcatcctcccttcttgcatagggcct----tatagtccatgacatgttt |
45018558 |
T |
 |
| Q |
175 |
tcagttgttttgtgtgacacaatgtaaacattggaggattttccatgaactctga |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45018557 |
tcagttgttttgtgtgacacaatgtaaacattggaggattttccatgaactctga |
45018503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 179 - 221
Target Start/End: Original strand, 3173127 - 3173169
Alignment:
| Q |
179 |
ttgttttgtgtgacacaatgtaaacattggaggattttccatg |
221 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
3173127 |
ttgttttgtgtgacacaatgtaaacggaggaggattttccatg |
3173169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University