View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0374_low_27 (Length: 291)
Name: NF0374_low_27
Description: NF0374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0374_low_27 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 166 - 231
Target Start/End: Complemental strand, 42992924 - 42992859
Alignment:
Q |
166 |
gtaactgataggatttggaagaatcggacgtttggttgctagagttgctttgaagagagatgatgt |
231 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
42992924 |
gtaactgataggatttggaagaatcggacgtttggttgctagagttgctttgaagagagatgatgt |
42992859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 54 - 122
Target Start/End: Complemental strand, 42993036 - 42992968
Alignment:
Q |
54 |
agatcaagatcggaatcaacggtaaatattctagttccttcgatctctgttcatttctgcgtcgatcgg |
122 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
T |
42993036 |
agatcaagatcggaatcaacggtaaatattatagttccttcgatctctgttcatttatgcgtcgatcgg |
42992968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 175 - 214
Target Start/End: Complemental strand, 38847730 - 38847691
Alignment:
Q |
175 |
aggatttggaagaatcggacgtttggttgctagagttgct |
214 |
Q |
|
|
||||||||||||||| ||||| |||||||||||||||||| |
|
|
T |
38847730 |
aggatttggaagaattggacgattggttgctagagttgct |
38847691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University