View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0374_low_33 (Length: 276)
Name: NF0374_low_33
Description: NF0374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0374_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 69 - 243
Target Start/End: Original strand, 41419167 - 41419328
Alignment:
| Q |
69 |
ttgaatgtttattcagtagtcttgttatctttagtgaattagtaaataacaatactcatacatccacttcaattcctttatactatttgatatgtatcat |
168 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41419167 |
ttgaatgtttattcagtagtcttgttatctttagtgaatta-------------ctcatacatccacttcaattcctttatactatttgatatgtatcat |
41419253 |
T |
|
| Q |
169 |
tatcatactagtacaaatctaaagttgatttatctttaacagtttataaaacaacaataaaacatgtagaataat |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41419254 |
tatcatactagtacaaatctaaagttgatttatctttaacagtttataaaacaacaataaaacatgtagaataat |
41419328 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 733 times since January 2019
Visitors: 3064