View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0374_low_34 (Length: 276)
Name: NF0374_low_34
Description: NF0374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0374_low_34 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 45 - 171
Target Start/End: Complemental strand, 28588803 - 28588677
Alignment:
Q |
45 |
catgaatttgtcaagttcattactcattcgaacacacacgctaggatagtatcaaagtttatctaagattttataagtgagagacactctcactgtacaa |
144 |
Q |
|
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
28588803 |
catgaatttgtcaagttcattactcattcgaatacacacgctaggatagtatcaaagtttatctaagattttataagtgagagacactctcactgtacaa |
28588704 |
T |
 |
Q |
145 |
gtggattttttgagaaagagttagact |
171 |
Q |
|
|
||||||||||||||||||||||||||| |
|
|
T |
28588703 |
gtggattttttgagaaagagttagact |
28588677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 172 - 269
Target Start/End: Complemental strand, 28588604 - 28588507
Alignment:
Q |
172 |
catgcttgtgcgattattgaacttaaatcatcatcaatcacttattataacttggttgtaaaattaaaccttgattagtcctcaactgtcctatgcta |
269 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
T |
28588604 |
catgcttgtgggattattgaacttaaatcatcatcaatcacttattataacttggttgtaaaattaaaccttgattagtcctcaactgttctatgcta |
28588507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University