View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0374_low_37 (Length: 273)
Name: NF0374_low_37
Description: NF0374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0374_low_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 264
Target Start/End: Complemental strand, 39378285 - 39378022
Alignment:
Q |
1 |
gacaaaagggtttacaaggtggtcttgtttaagaaaaagaacagaagatgaagaatcctcagagacacaaagttcttcagatagtgacgtggaaatatca |
100 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39378285 |
gacaaaagggtttacaaggtggtcttgtttaagaaaaagaacagaagatgaagaatcctcggagacacaaagttcttcagatagtgacgtggaaatatca |
39378186 |
T |
 |
Q |
101 |
cnnnnnnntgttgatgttgagaatcaaaagcaaggtgagaataaagctggtacgggttcgggtacgggcactctggtcatagttgatggtgaaagagagc |
200 |
Q |
|
|
| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
39378185 |
caaaaaaatgttgatgctgagaatcaaaagcaaggtgagaataaagctggtacgggttcgggtacaggcactctggtcatagttgatggtgaaagagagc |
39378086 |
T |
 |
Q |
201 |
ttgaagtggaaacacttttgaaagcttctgcgtatattttaggagctactggttcaagtataat |
264 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39378085 |
ttgaagtggaaacacttttgaaagcttctgcgtatattttaggagctactggttcaagtataat |
39378022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University