View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0374_low_43 (Length: 252)
Name: NF0374_low_43
Description: NF0374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0374_low_43 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 243
Target Start/End: Complemental strand, 8840402 - 8840160
Alignment:
Q |
1 |
aaatattttaaattgtgtatgtcaaatattcttgacattgcgaaaaattgcaatgtggttgcggacgcctccaaaacttgtatagaatttgtttctagac |
100 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
T |
8840402 |
aaatattttaaattgtgcatgtcaaatattcttgacatcgcgaaaaattgcaatgtggttgcggacgcctccaaaacatgtatagaatttgtttctagac |
8840303 |
T |
 |
Q |
101 |
acatgcatgcaattgatgtgactaaaattgtggttgcgatgtgattgcagagacctctaaaaacgtcataataatcgcattgcagagaaaaatatgacga |
200 |
Q |
|
|
|||||||||| |||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
T |
8840302 |
acatgcatgctattgatatgactaaaattgtggttgcaatgtgattgcagagacctctaaaaacgtcataataatcgcattgcggagaaaaatatgacga |
8840203 |
T |
 |
Q |
201 |
ttgctaattaatttttacattttaagctttcatttccctatgc |
243 |
Q |
|
|
|||||||||| ||||||||||||||||||||||||| |||||| |
|
|
T |
8840202 |
ttgctaattagtttttacattttaagctttcatttcactatgc |
8840160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1741 times since January 2019
Visitors: 3091