View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0374_low_50 (Length: 224)
Name: NF0374_low_50
Description: NF0374
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0374_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 1e-61; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 7 - 130
Target Start/End: Original strand, 6070483 - 6070606
Alignment:
Q |
7 |
cttattagattgatcaacatacactcgaactctttgggtgttataatcagcagtaacaaaatagccaggtggcaccactcgaatttcaactccattcatc |
106 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
6070483 |
cttattagattgatcaacatacaatcgaactctttgggtgttataatcagcagtaacaaaatagccaggtggcaccactcgaatttcaactccattcatc |
6070582 |
T |
 |
Q |
107 |
tcttcctttattttcctctctgct |
130 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
6070583 |
tcttcctttattttcctctctgct |
6070606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 65 - 130
Target Start/End: Complemental strand, 6055877 - 6055812
Alignment:
Q |
65 |
aaatagccaggtggcaccactcgaatttcaactccattcatctcttcctttattttcctctctgct |
130 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
6055877 |
aaatagccaggtggcaccactcgaatttcaactccatgcatctcttcctttattttcctctctgct |
6055812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 7 - 130
Target Start/End: Original strand, 6085559 - 6085682
Alignment:
Q |
7 |
cttattagattgatcaacatacactcgaactctttgggtgttataatcagcagtaacaaaatagccaggtggcaccactcgaatttcaactccattcatc |
106 |
Q |
|
|
||||||||||| ||||||||||| ||||||||| | | | |||||||||||||||| | |||| ||||||||| |||||||||||||| || |
|
|
T |
6085559 |
cttattagattcatcaacatacaatcgaactctcttgaacctgaaatcagcagtaacaaatgaatcagggggcaccacttgaatttcaactccagatata |
6085658 |
T |
 |
Q |
107 |
tcttcctttattttcctctctgct |
130 |
Q |
|
|
|||||||||||||| ||||||||| |
|
|
T |
6085659 |
tcttcctttatttttctctctgct |
6085682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 7 - 39
Target Start/End: Complemental strand, 6055920 - 6055888
Alignment:
Q |
7 |
cttattagattgatcaacatacactcgaactct |
39 |
Q |
|
|
||||||||||||||||||||||| ||||||||| |
|
|
T |
6055920 |
cttattagattgatcaacatacaatcgaactct |
6055888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1254 times since January 2019
Visitors: 3079