View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0375_low_12 (Length: 317)
Name: NF0375_low_12
Description: NF0375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0375_low_12 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 89 - 317
Target Start/End: Complemental strand, 49584429 - 49584201
Alignment:
| Q |
89 |
atcatcagttcgagatttacttaatctgaaatttcctgtcagaaagcttattatttctgagggttcaagcattgcacaagcttttcccttcggtattttt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49584429 |
atcatcagttcgagatttacttaatctgaagtttcctgtcagaaagcttattatttctgagggttcaagcattgcacaagcttttcccttcggtattttt |
49584330 |
T |
|
| Q |
189 |
gaaggaccgaccagaacaacttcattggattttacatcatcaacatgggggcatataagatcnnnnnnncctttaccgattgctaatccatcaacaaggg |
288 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
49584329 |
gaaggaccgaccagaacagcttcattggattttacatcatcaacatgggggcatataagatctttttttcctttaccgattgctaatccatcaacaaggg |
49584230 |
T |
|
| Q |
289 |
ctttgagcccaattaaatttttcagagtc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
49584229 |
ctttgagcccaattaaatttttcagagtc |
49584201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1401 times since January 2019
Visitors: 3084