View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0375_low_16 (Length: 284)
Name: NF0375_low_16
Description: NF0375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0375_low_16 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 89; Significance: 6e-43; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 96 - 200
Target Start/End: Complemental strand, 35387593 - 35387489
Alignment:
| Q |
96 |
cttcactcgtatctcttaattatgtcctcaaatgcttgtgtgaacaagcaagtattttctcatttttagtttctatctaggtgggatttagcatggaaaa |
195 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35387593 |
cttcactcctatctcttaattatgtcctcaaatgcttgtgtgagcaagcaagtattttctcatttttagtttctatctaggtggagtttagcatggaaaa |
35387494 |
T |
|
| Q |
196 |
gacta |
200 |
Q |
| |
|
||||| |
|
|
| T |
35387493 |
gacta |
35387489 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 228 - 274
Target Start/End: Original strand, 30272210 - 30272255
Alignment:
| Q |
228 |
ttttccacatcatcttccaccactacccttctccacctacctctgtg |
274 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||| |||| |
|
|
| T |
30272210 |
ttttccacatcatcttccaccaccacccttctcc-cctacctttgtg |
30272255 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 261
Target Start/End: Original strand, 36935743 - 36935776
Alignment:
| Q |
228 |
ttttccacatcatcttccaccactacccttctcc |
261 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| |
|
|
| T |
36935743 |
ttttccacatcatcttccaccaccacccttctcc |
36935776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 228 - 267
Target Start/End: Complemental strand, 10608256 - 10608217
Alignment:
| Q |
228 |
ttttccacatcatcttccaccactacccttctccacctac |
267 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
10608256 |
ttttccacatcatcttccaccaccacccttctccccctac |
10608217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 234 - 274
Target Start/End: Original strand, 931042 - 931082
Alignment:
| Q |
234 |
acatcatcttccaccactacccttctccacctacctctgtg |
274 |
Q |
| |
|
||||||||||||||||| |||||||||| ||||||| |||| |
|
|
| T |
931042 |
acatcatcttccaccaccacccttctccccctacctttgtg |
931082 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 232 - 274
Target Start/End: Complemental strand, 25655571 - 25655529
Alignment:
| Q |
232 |
ccacatcatcttccaccactacccttctccacctacctctgtg |
274 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||| |||| |
|
|
| T |
25655571 |
ccacatcatcttccaccaccacccttctccccctacctttgtg |
25655529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1645 times since January 2019
Visitors: 3091