View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0375_low_18 (Length: 256)
Name: NF0375_low_18
Description: NF0375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0375_low_18 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 48 - 158
Target Start/End: Complemental strand, 391850 - 391740
Alignment:
| Q |
48 |
ttctttttcaacgcttaaggggttggagtttcttcctcgtttcaagtttggatttatatttacgtcttttatgctgcaacattgatttattaggctacaa |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
391850 |
ttctttttcaacgcttaaggggttggagtttcttcctcgtttcaagtttggatttatatttacgtcttttatgctgcaacattgatttattaggctacaa |
391751 |
T |
 |
| Q |
148 |
catctgttttt |
158 |
Q |
| |
|
||||||||||| |
|
|
| T |
391750 |
catctgttttt |
391740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University