View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0375_low_18 (Length: 256)

Name: NF0375_low_18
Description: NF0375
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0375_low_18
NF0375_low_18
[»] chr6 (1 HSPs)
chr6 (48-158)||(391740-391850)


Alignment Details
Target: chr6 (Bit Score: 111; Significance: 4e-56; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 48 - 158
Target Start/End: Complemental strand, 391850 - 391740
Alignment:
48 ttctttttcaacgcttaaggggttggagtttcttcctcgtttcaagtttggatttatatttacgtcttttatgctgcaacattgatttattaggctacaa 147  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
391850 ttctttttcaacgcttaaggggttggagtttcttcctcgtttcaagtttggatttatatttacgtcttttatgctgcaacattgatttattaggctacaa 391751  T
148 catctgttttt 158  Q
    |||||||||||    
391750 catctgttttt 391740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University