View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0376_high_10 (Length: 314)
Name: NF0376_high_10
Description: NF0376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0376_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 164; Significance: 1e-87; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 27 - 198
Target Start/End: Complemental strand, 15129505 - 15129334
Alignment:
Q |
27 |
tggtcaacctaacgcatactacattttggtattcataactttttaatgacaagtcgactattattatttcaagctcaaatttgaaaagaatattaacaca |
126 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15129505 |
tggtcaacctaacgcatactacattttggtattcataactttttaatgacaagtagactattattatttcaagctcaaatttgaaaagaatattaacaca |
15129406 |
T |
 |
Q |
127 |
aagatgagagtagtagacaattatattatgcagcaaaataatattgattgaatttggtgagaggaatctcca |
198 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
15129405 |
aagatgagagtagtagacaattatattatgcagcaaaataattttgattgaatttggtgagaggaatctcca |
15129334 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 86 - 188
Target Start/End: Original strand, 5286430 - 5286535
Alignment:
Q |
86 |
attattatttcaagctcaaatttgaaaagaatattaacacaaag---atgagagtagtagacaattatattatgcagcaaaataatattgattgaatttg |
182 |
Q |
|
|
|||||||||| || |||||| || |||||||| ||||||| || || | |||||| ||||||||| ||||||||||| |||||| |||||||||||| |
|
|
T |
5286430 |
attattatttgaacctcaaaattaaaaagaatcttaacactaatgaaattaaagtagtggacaattatcttatgcagcaagataatactgattgaatttg |
5286529 |
T |
 |
Q |
183 |
gtgaga |
188 |
Q |
|
|
||||| |
|
|
T |
5286530 |
ctgaga |
5286535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University