View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0376_high_18 (Length: 225)
Name: NF0376_high_18
Description: NF0376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0376_high_18 |
 |  |
|
[»] scaffold0131 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr2 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 19710939 - 19710798
Alignment:
Q |
1 |
atattttattatcttatttctatgtttttcattgatcgaaaaacatactcaagtttgttatactgatctgttatcagagtgcgcaacggagtagtagagt |
100 |
Q |
|
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
19710939 |
atattttattatcttatttctatttttttcattgatcgaaaaacatactcaagtttgttatactgatctgttatcagagtgcgcagcggagtagtagagt |
19710840 |
T |
 |
Q |
101 |
tttattttcctatgatatatttgtagtatttaaaattctgat |
142 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
19710839 |
tttattttcctatgatatatttgtagtatttaaaattctgat |
19710798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0131 (Bit Score: 94; Significance: 5e-46; HSPs: 1)
Name: scaffold0131
Description:
Target: scaffold0131; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 25 - 142
Target Start/End: Original strand, 39471 - 39588
Alignment:
Q |
25 |
tttttcattgatcgaaaaacatactcaagtttgttatactgatctgttatcagagtgcgcaacggagtagtagagttttattttcctatgatatatttgt |
124 |
Q |
|
|
|||||||||||||| ||||||||||||||||||| |||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| ||||| |
|
|
T |
39471 |
tttttcattgatcggaaaacatactcaagtttgtcatactgatttgttatcagagtgcgcagcggagtagtagagttttattttcctatgatatttttgt |
39570 |
T |
 |
Q |
125 |
agtatttaaaattctgat |
142 |
Q |
|
|
||||||||||||| |||| |
|
|
T |
39571 |
agtatttaaaattttgat |
39588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1859 times since January 2019
Visitors: 3093