View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0376_high_5 (Length: 366)
Name: NF0376_high_5
Description: NF0376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0376_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 28 - 278
Target Start/End: Original strand, 27354791 - 27355041
Alignment:
| Q |
28 |
attaagtatctaatctttaaccttgaattcaaatgcaaaattttaagaggtttattttggtaaactgattannnnnnngataatgaaatgtaaacagann |
127 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
27354791 |
attaagtatctaatctttaaccttgaattcaaatgcaaaattttaagaggtttattttggtaaactgattatttttttgataatgaaatgtaaacagatt |
27354890 |
T |
 |
| Q |
128 |
nnnnnatttatcccgagtccacgttgagttgcatgctgctaccaattaagctatttaaatcaccgaatttttcatcatcattaatcagtaccaccaccac |
227 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27354891 |
tttttatttatcccgagtccacgttgagttgcatgctgctaccaattaagctatttaaatcaccgaatttttcatcatcattaatcagtaccaccaccac |
27354990 |
T |
 |
| Q |
228 |
atcatatacatgcagcaatgggcagaacccttgctcattgaacttatgtat |
278 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27354991 |
atcatatacatgcagcaatgggcggaacccttgctcattgaacttatgtat |
27355041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University