View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0376_low_10 (Length: 324)
Name: NF0376_low_10
Description: NF0376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0376_low_10 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 9e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 9e-98
Query Start/End: Original strand, 7 - 239
Target Start/End: Complemental strand, 5975532 - 5975299
Alignment:
| Q |
7 |
tatttgcttgatagtagacctataaaggatattgttgcagctcggtttaaaactcgactaatgtttgtcacaaaannnnnnnaactcgatttgattcaag |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
5975532 |
tatttgcttgatagtagacctataaaggatattgttgaagctcggtttaaaactcgactaatgtttgtcacaaattttttttaactcggtttgattcaag |
5975433 |
T |
 |
| Q |
107 |
ttaa-ccaacaattcatttcaacttgataagtttagttcgaatcaaacgaagcaaattagaataataaggactacattttcttagatcagaaatttgttg |
205 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5975432 |
ttaaaccaacaattcatttcaacttgataagtttagttcgtatcaaacgaagcaaagtagaataataaggactacattttcttagatcagaaatttgttg |
5975333 |
T |
 |
| Q |
206 |
actgcttttggatgcatctcatgtttgatgatgt |
239 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
5975332 |
actgcttttggatgcatctcatgttttatgatgt |
5975299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University