View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0376_low_15 (Length: 292)
Name: NF0376_low_15
Description: NF0376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0376_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 64 - 241
Target Start/End: Original strand, 6391713 - 6391890
Alignment:
| Q |
64 |
tcatcaaaggagttaaactctgcttgatcgttttgtaatctaaccagcgctcttaattcaggtgtctcatattgagatattgatttgatggtgttaacaa |
163 |
Q |
| |
|
||||||||||||||||||||| ||||||| ||||||||||| || |||| |||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6391713 |
tcatcaaaggagttaaactctacttgatcattttgtaatcttactagcgatcttaattgaggtgtctcatattgagatattgatttgatggtgttaacaa |
6391812 |
T |
 |
| Q |
164 |
caaagtctgacgatttctgagggataattaattcatctcttggaatgtaaaaatagttactccgactctcagtctctg |
241 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6391813 |
caaagtctgacgatttcggagggataattaattcatctcttggaatgtaaaaatagttactccgactctcagtctctg |
6391890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 64 - 241
Target Start/End: Original strand, 6410877 - 6411054
Alignment:
| Q |
64 |
tcatcaaaggagttaaactctgcttgatcgttttgtaatctaaccagcgctcttaattcaggtgtctcatattgagatattgatttgatggtgttaacaa |
163 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||| |||| |||||||| ||||||||||| |||||||||| |||||| ||||||||||| |
|
|
| T |
6410877 |
tcatcaaaggagttaaactctggttgatcgttttgtaatctaactagcgatcttaattgaggtgtctcatgttgagatattaatttgagggtgttaacaa |
6410976 |
T |
 |
| Q |
164 |
caaagtctgacgatttctgagggataattaattcatctcttggaatgtaaaaatagttactccgactctcagtctctg |
241 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||| |
|
|
| T |
6410977 |
caaagtctgacgatttctgagggatgattaattcatctcttggaatgtaaaaatatccactccgactctcggtctctg |
6411054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University