View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0376_low_18 (Length: 267)
Name: NF0376_low_18
Description: NF0376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0376_low_18 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 1868291 - 1868232
Alignment:
Q |
1 |
aaattctcgtcaaagtttttggttgccttgtttagctgatcttgtgtgaatattttagca |
60 |
Q |
|
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1868291 |
aaattctcgtcgaagtttttggttgccttgtttagctgatcttgtgtgaatattttagca |
1868232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 1842682 - 1842625
Alignment:
Q |
1 |
aaattctcgtcaaagtttttggttgccttgtttagctgatcttgtgtgaatattttag |
58 |
Q |
|
|
|||||||||||||||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
1842682 |
aaattctcgtcaaagtctttggtggccttgtttagctgatcttgtgtgaatattttag |
1842625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 127 - 175
Target Start/End: Complemental strand, 1842580 - 1842532
Alignment:
Q |
127 |
aaaatcaaaccaccattctgctcaaagaatttctctttcattttgatga |
175 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
1842580 |
aaaatcagaccaccattctgctcaaagaatttctctttcattttgatga |
1842532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 127 - 175
Target Start/End: Complemental strand, 1868165 - 1868117
Alignment:
Q |
127 |
aaaatcaaaccaccattctgctcaaagaatttctctttcattttgatga |
175 |
Q |
|
|
|||||||||||||||||||| || ||||||||||||||||||||||||| |
|
|
T |
1868165 |
aaaatcaaaccaccattctgttcgaagaatttctctttcattttgatga |
1868117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University