View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0376_low_18 (Length: 267)

Name: NF0376_low_18
Description: NF0376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0376_low_18
NF0376_low_18
[»] chr1 (4 HSPs)
chr1 (1-60)||(1868232-1868291)
chr1 (1-58)||(1842625-1842682)
chr1 (127-175)||(1842532-1842580)
chr1 (127-175)||(1868117-1868165)


Alignment Details
Target: chr1 (Bit Score: 56; Significance: 3e-23; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 1 - 60
Target Start/End: Complemental strand, 1868291 - 1868232
Alignment:
1 aaattctcgtcaaagtttttggttgccttgtttagctgatcttgtgtgaatattttagca 60  Q
    ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||    
1868291 aaattctcgtcgaagtttttggttgccttgtttagctgatcttgtgtgaatattttagca 1868232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 1842682 - 1842625
Alignment:
1 aaattctcgtcaaagtttttggttgccttgtttagctgatcttgtgtgaatattttag 58  Q
    |||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||    
1842682 aaattctcgtcaaagtctttggtggccttgtttagctgatcttgtgtgaatattttag 1842625  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 127 - 175
Target Start/End: Complemental strand, 1842580 - 1842532
Alignment:
127 aaaatcaaaccaccattctgctcaaagaatttctctttcattttgatga 175  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||    
1842580 aaaatcagaccaccattctgctcaaagaatttctctttcattttgatga 1842532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 127 - 175
Target Start/End: Complemental strand, 1868165 - 1868117
Alignment:
127 aaaatcaaaccaccattctgctcaaagaatttctctttcattttgatga 175  Q
    |||||||||||||||||||| || |||||||||||||||||||||||||    
1868165 aaaatcaaaccaccattctgttcgaagaatttctctttcattttgatga 1868117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1849 times since January 2019
Visitors: 3091