View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0376_low_19 (Length: 267)
Name: NF0376_low_19
Description: NF0376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0376_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 31 - 232
Target Start/End: Complemental strand, 12475258 - 12475057
Alignment:
Q |
31 |
agacgagatatccagagggaatgaggtgcagccaacagaaaatggatgggacaataatactcaacccctggatcaactaacagagcagatgggtcttctt |
130 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
12475258 |
agacgagatatccagagggaatgaggtgcagccaacagaaaatggatgggacaataatactcaacccctggatcaactaacagagcagatgggtcttctt |
12475159 |
T |
 |
Q |
131 |
tcctctgatgccaaaagaatttaatcatctatgaaatttttattgacctttcatactgtccaaggtaatccctgtcccaaaaaatacacaagtgatgatg |
230 |
Q |
|
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
12475158 |
tcttctgatgccaaaagaatttaatcatctatgaaatttttattgacctttcatactgtccaaggtaatctctgtcccaaaaaatacacaagtgatgatg |
12475059 |
T |
 |
Q |
231 |
tc |
232 |
Q |
|
|
|| |
|
|
T |
12475058 |
tc |
12475057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University