View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0376_low_23 (Length: 234)
Name: NF0376_low_23
Description: NF0376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0376_low_23 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 24715970 - 24715752
Alignment:
| Q |
1 |
tcatgttttatgataatttgatgttgaaattatcttttatataaataaattctagtgtgttttactaggtgatcatcatgatttgaattcttcatcaatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
24715970 |
tcatgttttatgataatttgatgttgaaattaatttttatataaataaattctagtgtgttttactaggtgatcatcatgagttgaattcttcatcaatt |
24715871 |
T |
|
| Q |
101 |
ttggattgtaaaataatttgacttaattgaatttgtttattggttggtatgtagtatatacaagtgagtagaatgtttatgattctccttagtgtgaggg |
200 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
24715870 |
ttggattggaaaataatttgacttaattgaattggtttattggttggtatatagtatatacaagtgaggagaatgtgtatgattctccttagtgtgaggg |
24715771 |
T |
|
| Q |
201 |
ttctagtatgatgatgtcc |
219 |
Q |
| |
|
| ||||||||||||||||| |
|
|
| T |
24715770 |
tactagtatgatgatgtcc |
24715752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 769 times since January 2019
Visitors: 3065