View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0376_low_24 (Length: 225)

Name: NF0376_low_24
Description: NF0376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0376_low_24
NF0376_low_24
[»] chr4 (2 HSPs)
chr4 (82-225)||(55825297-55825440)
chr4 (82-225)||(56149541-56149684)


Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 82 - 225
Target Start/End: Complemental strand, 55825440 - 55825297
Alignment:
82 agcagagaaaaagctagaacttgttttggaagaggctaaagcagcaaaagcagcagaacaaaaagccattaaagagatgaagattatctccgacgtgcaa 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
55825440 agcagagaaaaagctagaacttgttttggaagaggctaaagcagcaaaagcagcagaacaaaaagccattaaagagatgaagattatctccgacgtgcaa 55825341  T
182 agtagactctcgatttcaaaattcagcggaaagatcaggatgtc 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
55825340 agtagactctcgatttcaaaattcagcggaaagatcaggatgtc 55825297  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 82 - 225
Target Start/End: Original strand, 56149541 - 56149684
Alignment:
82 agcagagaaaaagctagaacttgttttggaagaggctaaagcagcaaaagcagcagaacaaaaagccattaaagagatgaagattatctccgacgtgcaa 181  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
56149541 agcagagaaaaagctagaacttgttttggaagaggctaaagcagcaaaagcagcagaacaaaaagccattaaagagatgaagattatctccgacgtgcaa 56149640  T
182 agtagactctcgatttcaaaattcagcggaaagatcaggatgtc 225  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
56149641 agtagactctcgatttcaaaattcagcggaaagatcaggatgtc 56149684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University