View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0376_low_24 (Length: 225)
Name: NF0376_low_24
Description: NF0376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0376_low_24 |
 | |
|
| [»] chr4 (2 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 144; Significance: 7e-76; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 82 - 225
Target Start/End: Complemental strand, 55825440 - 55825297
Alignment:
| Q |
82 |
agcagagaaaaagctagaacttgttttggaagaggctaaagcagcaaaagcagcagaacaaaaagccattaaagagatgaagattatctccgacgtgcaa |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55825440 |
agcagagaaaaagctagaacttgttttggaagaggctaaagcagcaaaagcagcagaacaaaaagccattaaagagatgaagattatctccgacgtgcaa |
55825341 |
T |
|
| Q |
182 |
agtagactctcgatttcaaaattcagcggaaagatcaggatgtc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55825340 |
agtagactctcgatttcaaaattcagcggaaagatcaggatgtc |
55825297 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 144; E-Value: 7e-76
Query Start/End: Original strand, 82 - 225
Target Start/End: Original strand, 56149541 - 56149684
Alignment:
| Q |
82 |
agcagagaaaaagctagaacttgttttggaagaggctaaagcagcaaaagcagcagaacaaaaagccattaaagagatgaagattatctccgacgtgcaa |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56149541 |
agcagagaaaaagctagaacttgttttggaagaggctaaagcagcaaaagcagcagaacaaaaagccattaaagagatgaagattatctccgacgtgcaa |
56149640 |
T |
|
| Q |
182 |
agtagactctcgatttcaaaattcagcggaaagatcaggatgtc |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56149641 |
agtagactctcgatttcaaaattcagcggaaagatcaggatgtc |
56149684 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University