View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0376_low_26 (Length: 213)
Name: NF0376_low_26
Description: NF0376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0376_low_26 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 84; Significance: 4e-40; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 106 - 197
Target Start/End: Original strand, 6222427 - 6222518
Alignment:
| Q |
106 |
agtatcataggttttgacggcggtgagagacggaaagataccggaattctgtgggtgtgtggctaagttgacggtggcgaaggtgccactac |
197 |
Q |
| |
|
||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6222427 |
agtatcagaggttttgactgcggtgagagacggaaagataccggaattctgtgggtgtgtggctaagttgacggtggcgaaggtgccactac |
6222518 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 746 times since January 2019
Visitors: 3064