View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0376_low_3 (Length: 446)
Name: NF0376_low_3
Description: NF0376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0376_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 148; Significance: 6e-78; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 148; E-Value: 6e-78
Query Start/End: Original strand, 11 - 178
Target Start/End: Original strand, 51231404 - 51231571
Alignment:
Q |
11 |
ttatactgtggggtatctttatttaggtcccttccatatggctgtatatgtacgcagtgctctctcttttggggtgtttttctttatttgccttgtcatt |
110 |
Q |
|
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51231404 |
ttattctgtggggtatctttatttaggtcccttccatatggctgtatatgtacacagtgctctctcttttggggtgtttttctttatttgccttgtcatt |
51231503 |
T |
 |
Q |
111 |
atttttggatggagtctacgttatagtgatatactctatatttccatttaatatattctccttgcctt |
178 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||| ||||| |
|
|
T |
51231504 |
atttttggatggagtctacgttatagtgatatactctatatttcctttttatatattctcctagcctt |
51231571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 107; E-Value: 2e-53
Query Start/End: Original strand, 257 - 417
Target Start/End: Original strand, 51231649 - 51231801
Alignment:
Q |
257 |
gatgaactatatcagtagaaattctgtcaaaaacaaacgaattatgattgtatgatatatatgatannnnnnnnnnattacagtgagggccaaaacacgt |
356 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||| ||| |
|
|
T |
51231649 |
gatgaactatatcagtataaattctgtcaaaaacaaacgaattatgattgtatgatatatatttt--------tttattacagtgagggccaaaacccgt |
51231740 |
T |
 |
Q |
357 |
atgtatgatatgattttagtgttccaaatttttacaaatagaagtcacctacgattagatg |
417 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
51231741 |
atgtatgatatgattttagtgttccaaatttttacaaatagaagtcacctacgattagatg |
51231801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University