View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0376_low_5 (Length: 385)
Name: NF0376_low_5
Description: NF0376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0376_low_5 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 90 - 385
Target Start/End: Original strand, 34451899 - 34452193
Alignment:
Q |
90 |
acaatagttttgtagctttagtttgttgcattgcattgtagaagtagttttcaaataaagtcttaaatttgcctttatgggacacatagtgtgatttgtc |
189 |
Q |
|
|
||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34451899 |
acaatagttctgtagctttagtttgttgcattgcatggtagaagtagttttcaaataaagtcttaaatttgcctttatgggacacatagtgtgatttgtc |
34451998 |
T |
 |
Q |
190 |
atatgatgggaacagtccnnnnnnngcaacctacagtattaccctttcttctttaattagatctttcatcatcaattcacaaagatcaaacnnnnnnnnn |
289 |
Q |
|
|
|||||||||||||||||| |||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||| | |
|
|
T |
34451999 |
atatgatgggaacagtccaacaaaagcaacctacagtattaccttttcttctttaatcagatctttcatcatcaattcacaaagatcaagc-tttttttt |
34452097 |
T |
 |
Q |
290 |
ngcatcacaataacatcctttccttgtctcattttattttgtggatgaaatgaatctttaatccttttttcttcaataagcaatgaatcttaatct |
385 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34452098 |
tgcatcacaataacatcctttccttgtctcattttattttgtggatgaaatgaatctttaatccttttttcttcaataagcaatgaatcttaatct |
34452193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 481 times since January 2019
Visitors: 3060