View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0376_low_7 (Length: 365)
Name: NF0376_low_7
Description: NF0376
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0376_low_7 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 8 - 286
Target Start/End: Complemental strand, 27354778 - 27354500
Alignment:
| Q |
8 |
gttcgatctctttgtctctttagtgttatatcgtttgaacctcttgctgttttgtttgttgtgacttgtgagcagcttgggatgtctcaatatattgtgt |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27354778 |
gttcgatctctttgtctctttagtgttatatcgtttgaacctcttgctgttttgtttgttgtgacttgtgagcagcttgggatatctcaatatattgtgt |
27354679 |
T |
|
| Q |
108 |
aaatagtcaatatagtcttctccatataacgaagatggcaattgatccggtttattgttgagtcctaagaaagaataggtaagaaagctattcttttgac |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27354678 |
aaatagtcaatatagtcttctccatataacgaagatggcaattgatccggtttattgttgagtcctaagaaagaataggtaagaaagctattcttttgac |
27354579 |
T |
|
| Q |
208 |
catgtatgcgacatagtgttgatcgattaagcggtaaagaatcaacatgagaataaaataaaagtagagatgatgatgt |
286 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
27354578 |
catgtatgcgacatattgttgatcgattaagcggtaaagaatcaacatgagaataaaataaaagtagagatgaagatgt |
27354500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 896 times since January 2019
Visitors: 3072