View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0377_high_7 (Length: 249)
Name: NF0377_high_7
Description: NF0377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0377_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 11352761 - 11352540
Alignment:
| Q |
1 |
tataataactaatcaaagacgtacacattcgaggactacaaagacaaataaaatacacaagcagagatatttttgcattttgatttatttatagactata |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11352761 |
tataataactaatcaaagacgtacacattcgaggactacaaagacaaataaaatacacaagcagagatatttttgcattttgatttatttatagactata |
11352662 |
T |
 |
| Q |
101 |
ttgaccgcgcttcacacatttaagcacgaaaatgcatgtttattcaataaaaaatctctcatatatgtgcactcactgcaattcccttgagattgaattt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11352661 |
ttgaccgcgcttcacacatttaagcacgaaaatgcatgtttattcaataaaaaatctctcatatatgtgcactcactgcaattcccttgagattgaattt |
11352562 |
T |
 |
| Q |
201 |
gcttttggtttgaacaatgagt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
11352561 |
gcttttggtttgaacaatgagt |
11352540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University