View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0377_low_3 (Length: 333)

Name: NF0377_low_3
Description: NF0377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0377_low_3
NF0377_low_3
[»] chr4 (1 HSPs)
chr4 (85-236)||(51755925-51756082)


Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 85 - 236
Target Start/End: Original strand, 51755925 - 51756082
Alignment:
85 caaagggaaagatgaagtttaccttgtattattatgac------gatgaagatgacattgacagagaatgcaaggaaagtgttgagacgttnnnnnnnnt 178  Q
    ||||||||||||||||||||||||||||||||||||||      |||||||||||||||||||||||||||||||| ||||||||||||||        |    
51755925 caaagggaaagatgaagtttaccttgtattattatgaccatgaagatgaagatgacattgacagagaatgcaaggagagtgttgagacgttaaaaaaaat 51756024  T
179 aacggaggaattatgggaagagaaagaaggaagattagggtggtgggagagttgggaa 236  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51756025 aacggaggaattatgggaagagaaagaaggaagattagggtggtgggagagttgggaa 51756082  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 721 times since January 2019
Visitors: 3064