View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0377_low_3 (Length: 333)
Name: NF0377_low_3
Description: NF0377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0377_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 85 - 236
Target Start/End: Original strand, 51755925 - 51756082
Alignment:
| Q |
85 |
caaagggaaagatgaagtttaccttgtattattatgac------gatgaagatgacattgacagagaatgcaaggaaagtgttgagacgttnnnnnnnnt |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| | |
|
|
| T |
51755925 |
caaagggaaagatgaagtttaccttgtattattatgaccatgaagatgaagatgacattgacagagaatgcaaggagagtgttgagacgttaaaaaaaat |
51756024 |
T |
 |
| Q |
179 |
aacggaggaattatgggaagagaaagaaggaagattagggtggtgggagagttgggaa |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51756025 |
aacggaggaattatgggaagagaaagaaggaagattagggtggtgggagagttgggaa |
51756082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University