View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0377_low_4 (Length: 318)
Name: NF0377_low_4
Description: NF0377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0377_low_4 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 90 - 241
Target Start/End: Complemental strand, 8465676 - 8465525
Alignment:
Q |
90 |
acatcatcattaagtggtagtaggtgattaacaataaacaaacatcataattcataatggtagtaggtgttggatttttgtgctatatttgatacaataa |
189 |
Q |
|
|
||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8465676 |
acatcataattaagtggtagtaagtgattaacaataaacaaacatcataattcataatggtagtaggtgttggatttttgtgctatatttgatacaataa |
8465577 |
T |
 |
Q |
190 |
gtggctcatttcgatgcttctctcttcatcattcattcactcactctctgtg |
241 |
Q |
|
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
T |
8465576 |
gtggctcatttcgatgcttctctgttcatcattcattcactcactctctgtg |
8465525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 100 - 141
Target Start/End: Complemental strand, 8465707 - 8465666
Alignment:
Q |
100 |
taagtggtagtaggtgattaacaataaacaaacatcataatt |
141 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
8465707 |
taagtggtagtaggtgattaacaataaacaaacatcataatt |
8465666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University