View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0377_low_7 (Length: 266)

Name: NF0377_low_7
Description: NF0377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0377_low_7
NF0377_low_7
[»] chr7 (1 HSPs)
chr7 (31-266)||(35749711-35749940)


Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 31 - 266
Target Start/End: Complemental strand, 35749940 - 35749711
Alignment:
31 caattacactgaactatgttattttcaaatgattagctatgtttcagtgtcggtgtccgtgtcgtatccgttgatatccgtgcctcacattcacttctca 130  Q
    |||||||||||||  ||||||||||||||||||||||||||||||||||||||||||      |||||||||| ||||||||||||||||||||||||||    
35749940 caattacactgaataatgttattttcaaatgattagctatgtttcagtgtcggtgtc------gtatccgttggtatccgtgcctcacattcacttctca 35749847  T
131 tagcatgcaacccacatgggttggcccaactatatatgtttgagacattggaatgtgctcctcttatagtctcaattttgaattccggtgccaattttaa 230  Q
    ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||    
35749846 tagcatgcaacccacatgggttggcgcaactatatatgtttgagacattggaatgtgctcttcttatagtctcaattttgaattccggtgccaattttaa 35749747  T
231 tgagctatagtttattgctctggctttttaaacggg 266  Q
    |||||| |||||||||||||||||||||||||||||    
35749746 tgagctctagtttattgctctggctttttaaacggg 35749711  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1041 times since January 2019
Visitors: 3075