View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0377_low_7 (Length: 266)
Name: NF0377_low_7
Description: NF0377
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0377_low_7 |
 |  |
|
[»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 31 - 266
Target Start/End: Complemental strand, 35749940 - 35749711
Alignment:
Q |
31 |
caattacactgaactatgttattttcaaatgattagctatgtttcagtgtcggtgtccgtgtcgtatccgttgatatccgtgcctcacattcacttctca |
130 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||| |
|
|
T |
35749940 |
caattacactgaataatgttattttcaaatgattagctatgtttcagtgtcggtgtc------gtatccgttggtatccgtgcctcacattcacttctca |
35749847 |
T |
 |
Q |
131 |
tagcatgcaacccacatgggttggcccaactatatatgtttgagacattggaatgtgctcctcttatagtctcaattttgaattccggtgccaattttaa |
230 |
Q |
|
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35749846 |
tagcatgcaacccacatgggttggcgcaactatatatgtttgagacattggaatgtgctcttcttatagtctcaattttgaattccggtgccaattttaa |
35749747 |
T |
 |
Q |
231 |
tgagctatagtttattgctctggctttttaaacggg |
266 |
Q |
|
|
|||||| ||||||||||||||||||||||||||||| |
|
|
T |
35749746 |
tgagctctagtttattgctctggctttttaaacggg |
35749711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1041 times since January 2019
Visitors: 3075