View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0378_low_13 (Length: 316)
Name: NF0378_low_13
Description: NF0378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0378_low_13 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 159; Significance: 1e-84; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 140 - 306
Target Start/End: Original strand, 15054314 - 15054480
Alignment:
| Q |
140 |
tgaacagatttcgtgccaacgtctaaaaaatatggtcaaacaatgtgaaactcgcgcggcagaagataccagtagagacatcatgttaaaggttagaaag |
239 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
15054314 |
tgaacagatttcgtgccaacgtctcaaaaatatggtcaaacaatgtgaaactcgcgcggcagaagataccagtagagacatcatgttaagggttagaaag |
15054413 |
T |
|
| Q |
240 |
ttttgcatgaggaactaatttactacgttttttcatcattcggcgtttgcgaccttgttgcttcatc |
306 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15054414 |
ttttgcatgaggaactaatttactacgttttttcatcattcggcgtttgcgaccttgttgcttcatc |
15054480 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 91 - 144
Target Start/End: Complemental strand, 10300146 - 10300093
Alignment:
| Q |
91 |
ataatttggttttgtcataaaaagatgacagtggaaaaaggtagcaacatgaac |
144 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10300146 |
ataatttggttttgtcataaaaagatgacagtggaaaaaggtagcaacatgaac |
10300093 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1583 times since January 2019
Visitors: 3090