View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0378_low_15 (Length: 295)
Name: NF0378_low_15
Description: NF0378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0378_low_15 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 6e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 28 - 136
Target Start/End: Original strand, 22231931 - 22232044
Alignment:
| Q |
28 |
cactgctgagtggtgagggggcttgtcaggaatccttcaatctgaatttttgttt-----ggtggaaaatagattttcttttcatcttttgtaataataa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22231931 |
cactgctgagtggtgagggggcttgtcaggaatccttcaatctgaatttttgtttaatttggtggaaaatagattttcttttcatcttttgtaataataa |
22232030 |
T |
|
| Q |
123 |
tatgcgatgttctt |
136 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
22232031 |
tatgcgatgttctt |
22232044 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 188 - 284
Target Start/End: Original strand, 22232096 - 22232192
Alignment:
| Q |
188 |
cagttgctgccaaaacacaaaccacactgcattttccaagttgtctcacatattaaatgagcaactgtatatgttgctatgtttgtcggatattcat |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
22232096 |
cagttgctgccaaaacacaaaccacactgcattttccaagttgtctcacatattaaatgagcaactgtatatgttactatgtttgtcggatattcat |
22232192 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1293 times since January 2019
Visitors: 3079