View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0378_low_19 (Length: 250)
Name: NF0378_low_19
Description: NF0378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0378_low_19 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 91 - 243
Target Start/End: Complemental strand, 10300146 - 10299994
Alignment:
Q |
91 |
ataatttggttttgtcataaaaagatgacagtggaaaaaggtagcaacatgaaccatcaacaacagccatttgaagtatccattgacactgctggttcca |
190 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
10300146 |
ataatttggttttgtcataaaaagatgacagtggaaaaaggtagcaacatgaaccatcaacaacagccatttgaagtatccattgacactgctggttcca |
10300047 |
T |
 |
Q |
191 |
agtgttttgacgacgatggccgtttaaaacgaactggtaaattcattcatctc |
243 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
10300046 |
agtgttttgacgacgatggccgtttaaaacgaactggtaaattcattcttctc |
10299994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University