View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0378_low_4 (Length: 599)
Name: NF0378_low_4
Description: NF0378
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0378_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 64; Significance: 1e-27; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 64; E-Value: 1e-27
Query Start/End: Original strand, 261 - 340
Target Start/End: Complemental strand, 33169908 - 33169829
Alignment:
Q |
261 |
gttcacctgagtcacgtttaaatttgtcaaaatgtgttattctaagatgcacatgtaatttattttcataagtttgatgt |
340 |
Q |
|
|
|||||||||||| | ||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
T |
33169908 |
gttcacctgagttatgtttaaacttgtcaaaatgtgttattctaagatgcacatgcaatttattttcataagtttgatgt |
33169829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 1e-18
Query Start/End: Original strand, 53 - 126
Target Start/End: Complemental strand, 33170095 - 33170018
Alignment:
Q |
53 |
gaagttgtgaacattgaggattgcacatat----ccttcatcaattccactttatgtttcatatgactactttaaagc |
126 |
Q |
|
|
|||||||||||||||||||| ||||||||| |||||||||| |||||||| |||||||||||||||||||||||| |
|
|
T |
33170095 |
gaagttgtgaacattgaggactgcacatatacatccttcatcaagtccactttgtgtttcatatgactactttaaagc |
33170018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 447 - 492
Target Start/End: Complemental strand, 33169754 - 33169709
Alignment:
Q |
447 |
aatagaaatgtgagtgataagagaggtgagtacaattttcgctaaa |
492 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
33169754 |
aatagaaatgtgagtgataagagaggtgagtacaattttccctaaa |
33169709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 79 - 141
Target Start/End: Complemental strand, 33175286 - 33175224
Alignment:
Q |
79 |
atatccttcatcaattccactttatgtttcatatgactactttaaagctggacgactctctat |
141 |
Q |
|
|
|||||||||||||| | || |||||||||||||||| |||||||||| ||||| |||||||| |
|
|
T |
33175286 |
atatccttcatcaagtgcaatttatgtttcatatgattactttaaagatggacttctctctat |
33175224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University