View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0379_high_2 (Length: 251)
Name: NF0379_high_2
Description: NF0379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0379_high_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 243
Target Start/End: Original strand, 34442324 - 34442563
Alignment:
Q |
1 |
ataaaaaatgattagaaaaattgtggcgtgacattgtcactgccgttaagaggatttatccacctcataagtgcgagtcccccaaaatatacaacatgat |
100 |
Q |
|
|
|||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34442324 |
ataaaaaatgattataaaaattgtgacgtgacattgtcactgccgttaagaggatttatccacctcataagtgcgagtcccccaaaatatacaacatgat |
34442423 |
T |
 |
Q |
101 |
cttcctgagtgatgtcactatgtcgtgttgtatgatgtgttttagaannnnnnnnnnatgcattttagataagtcttaagtagttttagacagtttggag |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
34442424 |
cttcctgagtgatgtcactatgtcgtgttgtatgatgtgttttagaa---tttttttatgcattttcgataagtcttaagtagttttagacagtttggag |
34442520 |
T |
 |
Q |
201 |
atgaaaatatcaagaaaatcaaggttcctgatccagaataatc |
243 |
Q |
|
|
|||||||||||||||||||||||||||||| ||||||| |||| |
|
|
T |
34442521 |
atgaaaatatcaagaaaatcaaggttcctggtccagaacaatc |
34442563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University