View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0379_low_2 (Length: 300)
Name: NF0379_low_2
Description: NF0379
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0379_low_2 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 11 - 261
Target Start/End: Original strand, 34442025 - 34442275
Alignment:
Q |
11 |
gtaacaaaccctgcacaccaccaactgttccagatggtgactcctcctttacgatttcttcatattatatttggattcttcatagtctatattttgcaca |
110 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
34442025 |
gtaacaaaccctgcacaccaccaactgttccagatggtgactcctcctttacgatttcttcatattatatttggattcttcatagtctatattttgcaca |
34442124 |
T |
 |
Q |
111 |
tcttggatcgtgtgacgctgaagccagtgttttcatggaagcaacaagcacctcttgcgatgcatgatatgcactagaatgtgtggcttccagtcactca |
210 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
34442125 |
tcttggatcgtgtgacgctgaagccagtgttttcatggaagcaacaagcacctcttgcgatgcatgatatgcactagaatgcgtggcttccagtcactca |
34442224 |
T |
 |
Q |
211 |
cactccaagattatgtctttgaaggaaagactcaactcttcttccacaggt |
261 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
34442225 |
cactccaagattatgtctttgaaggaaagactcaactcttcttccataggt |
34442275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University