View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0380_high_12 (Length: 301)
Name: NF0380_high_12
Description: NF0380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0380_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 5 - 274
Target Start/End: Complemental strand, 2653802 - 2653540
Alignment:
| Q |
5 |
gaggagcagagaaaaatgtctaatattcacaagggaattcatcgaccctctatgctgaacccgcctttttcacctattgggcgagtatgaagtgtcgtct |
104 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| ||| |
|
|
| T |
2653802 |
gaggagaagagaaaaatgtctaatattcacaagggaattcatcgaccctctatgctgaaccagcctttttcgcctattgggcgagtatgaagtgtcttct |
2653703 |
T |
|
| Q |
105 |
cacacttgaattccaacacagcctgattgaagaccacaactcgagcgaaaatatctattgccagctatgagtccatattgtatgcaattgttagtaggaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2653702 |
cacacttgaattccaacacagcctgattgaagaccacaactcgagcgaaaatatctattgccagctatgagtccatattgtatgcaattgttagta---- |
2653607 |
T |
|
| Q |
205 |
gtaggaactgaaattttgtaagaagtgaacatggtaaggatgagattcacatcaatatatgtaggaggtg |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2653606 |
---ggaactgaaattttgtaagaagtgaacatggtgaggatgagattcacatcaatatatgtaggaggtg |
2653540 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1901 times since January 2019
Visitors: 3094