View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0380_high_12 (Length: 301)

Name: NF0380_high_12
Description: NF0380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0380_high_12
NF0380_high_12
[»] chr5 (1 HSPs)
chr5 (5-274)||(2653540-2653802)


Alignment Details
Target: chr5 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 5 - 274
Target Start/End: Complemental strand, 2653802 - 2653540
Alignment:
5 gaggagcagagaaaaatgtctaatattcacaagggaattcatcgaccctctatgctgaacccgcctttttcacctattgggcgagtatgaagtgtcgtct 104  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| |||    
2653802 gaggagaagagaaaaatgtctaatattcacaagggaattcatcgaccctctatgctgaaccagcctttttcgcctattgggcgagtatgaagtgtcttct 2653703  T
105 cacacttgaattccaacacagcctgattgaagaccacaactcgagcgaaaatatctattgccagctatgagtccatattgtatgcaattgttagtaggaa 204  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||        
2653702 cacacttgaattccaacacagcctgattgaagaccacaactcgagcgaaaatatctattgccagctatgagtccatattgtatgcaattgttagta---- 2653607  T
205 gtaggaactgaaattttgtaagaagtgaacatggtaaggatgagattcacatcaatatatgtaggaggtg 274  Q
       |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||    
2653606 ---ggaactgaaattttgtaagaagtgaacatggtgaggatgagattcacatcaatatatgtaggaggtg 2653540  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1901 times since January 2019
Visitors: 3094