View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0380_high_16 (Length: 291)
Name: NF0380_high_16
Description: NF0380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0380_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 1 - 269
Target Start/End: Original strand, 37272660 - 37272928
Alignment:
Q |
1 |
ctggtgctacaacaaacaacagaagctgacccctgttatcactaccagcagcttcagcaattgcagccatttcactagcaattgcatcttgtgttgatac |
100 |
Q |
|
|
|||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
T |
37272660 |
ctggtgttaccacaaacaacagaagctgacccctgttatcactaccagcagcttcagcaattgcagtcatttcactagcaattgcatcttgtgttgatac |
37272759 |
T |
 |
Q |
101 |
aaaccctgaagctgctaacccacccccaagacctaaaccaattataactcctttatcgttacgcatacggttgatttggttaagtgctggttgaagaatg |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
37272760 |
aaaccctgaagctgctaacccacccccaagacctaaaccaattataactcctttatcgttacgcatacggttgatttggttaagtgctggttgaagaatg |
37272859 |
T |
 |
Q |
201 |
ttgtacagaacccaagcaatggctggaattaatggtaacgaaagtgctaaaccacggttgtctgatgat |
269 |
Q |
|
|
||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
T |
37272860 |
ttgtacagaacccaagctatggctggaattaatggtaacaaaagtgctaaaccacggttgtctgatgat |
37272928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 155; Significance: 3e-82; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 67 - 269
Target Start/End: Original strand, 20580779 - 20580981
Alignment:
Q |
67 |
ccatttcactagcaattgcatcttgtgttgatacaaaccctgaagctgctaacccacccccaagacctaaaccaattataactcctttatcgttacgcat |
166 |
Q |
|
|
||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||| |||||||| |||||||| ||||||||||||||||||||||| |
|
|
T |
20580779 |
ccatttcactagccattgcatcttgtgttgacacaaaccctgaagctgctaacccaccaccaagacccaaaccaatgataactcctttatcgttacgcat |
20580878 |
T |
 |
Q |
167 |
acggttgatttggttaagtgctggttgaagaatgttgtacagaacccaagcaatggctggaattaatggtaacgaaagtgctaaaccacggttgtctgat |
266 |
Q |
|
|
||||||||||||||||||||||||||||||||||||| |||||||| |||| ||||||||||||||||||||| ||||||| |||| |||||||||||| |
|
|
T |
20580879 |
acggttgatttggttaagtgctggttgaagaatgttgaacagaaccgaagctatggctggaattaatggtaacagaagtgcttaaccgcggttgtctgat |
20580978 |
T |
 |
Q |
267 |
gat |
269 |
Q |
|
|
||| |
|
|
T |
20580979 |
gat |
20580981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1991 times since January 2019
Visitors: 3095