View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0380_high_31 (Length: 237)

Name: NF0380_high_31
Description: NF0380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0380_high_31
NF0380_high_31
[»] chr7 (1 HSPs)
chr7 (1-128)||(10194142-10194264)


Alignment Details
Target: chr7 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 10194142 - 10194264
Alignment:
1 ctggtattgcaatttgtcataaactgcatcgcatcaattgcattcactgcaacatggaacttatcaaaattttctgtccctaacaccattccgggcatcc 100  Q
    |||||||||||||||||||||||||     | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
10194142 ctggtattgcaatttgtcataaact-----gaatcaattgcattcactgcaacatggaacttatcaaaattttctgtccctaacaccattccaggcatcc 10194236  T
101 tgatatcaggatcaaggaattcgaactc 128  Q
    ||||||||||||||||||||||||||||    
10194237 tgatatcaggatcaaggaattcgaactc 10194264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1810 times since January 2019
Visitors: 3091