View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0380_low_12 (Length: 315)
Name: NF0380_low_12
Description: NF0380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0380_low_12 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 159; Significance: 1e-84; HSPs: 12)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 95 - 277
Target Start/End: Original strand, 3220243 - 3220425
Alignment:
| Q |
95 |
gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3220243 |
gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat |
3220342 |
T |
 |
| Q |
195 |
cgctggtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtt |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||| |||| || ||||| |
|
|
| T |
3220343 |
cgctggtttttgcactgatggtttctgcatcgttggtttttgcactgatggtttctgcatcgatggtttttgcaccgatggtt |
3220425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 113 - 315
Target Start/End: Original strand, 3220186 - 3220388
Alignment:
| Q |
113 |
tttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactga |
212 |
Q |
| |
|
|||||||| ||||||| |||| | ||||| | |||| | ||||||| |||| |||||||| |||||||||||||| |||||| |||||||||||| | |
|
|
| T |
3220186 |
tttgcatcgatggtttatgcatcgatggtttttgcaccaatggtttatgcatcgatggtttttgcaccgatggtttttgcatcaatggtttttgcaccaa |
3220285 |
T |
 |
| Q |
213 |
tggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttctgcatcgatggtttttgc |
312 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
3220286 |
tggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttctgcatcgttggtttttgc |
3220385 |
T |
 |
| Q |
313 |
act |
315 |
Q |
| |
|
||| |
|
|
| T |
3220386 |
act |
3220388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 95 - 314
Target Start/End: Original strand, 3220198 - 3220417
Alignment:
| Q |
95 |
gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat |
194 |
Q |
| |
|
|||| |||| |||||||||||||| ||||||||| |||| | ||||| | |||| |||||||||||||| ||||||| |||||| ||||| ||||||| |
|
|
| T |
3220198 |
gtttatgcatcgatggtttttgcaccaatggtttatgcatcgatggtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcat |
3220297 |
T |
 |
| Q |
195 |
cgctggtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttc |
294 |
Q |
| |
|
|| ||||||||||||||||||||| |||| ||||||||| |||| | |||||| ||||| |||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3220298 |
cgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttctgcatcgttggtttttgcactgatggtttc |
3220397 |
T |
 |
| Q |
295 |
tgcatcgatggtttttgcac |
314 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
3220398 |
tgcatcgatggtttttgcac |
3220417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 95 - 314
Target Start/End: Original strand, 3220408 - 3220642
Alignment:
| Q |
95 |
gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat |
194 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| | || |||||||| |||||| |
|
|
| T |
3220408 |
gtttttgcaccgatggttgctgcatcaatggtttttgcactaatggtgtctgcatcgatggtttttgcaacgatggttttttcatcgatggttgctgcat |
3220507 |
T |
 |
| Q |
195 |
cgctggtttttgcactgatggtttctgcatcgatggtttttgcactg---------------atggtttatgcaccgatggtttctgcatcgctggtttt |
279 |
Q |
| |
|
|| ||||||||||||| ||||||||| |||||||||||||||||| | ||||||| |||||||||||| ||||||||| ||||||| |
|
|
| T |
3220508 |
cgatggtttttgcactaatggtttcttcatcgatggtttttgcaccgctggttgctgcatcaatggtttttgcaccgatggtgtctgcatcgatggtttt |
3220607 |
T |
 |
| Q |
280 |
tgcactgatggtttctgcatcgatggtttttgcac |
314 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
3220608 |
tgcaccgatggttgctgcatcgatggtttttgcac |
3220642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 95 - 314
Target Start/End: Original strand, 3220318 - 3220552
Alignment:
| Q |
95 |
gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgca---------------c |
179 |
Q |
| |
|
|||| |||||||||||||| |||||| |||||||||||| ||||| ||||||||| ||||||||||||||||||||| |||| | |
|
|
| T |
3220318 |
gtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttctgcatcgttggtttttgcactgatggtttctgcatcgatggtttttgcac |
3220417 |
T |
 |
| Q |
180 |
cgatggtttctgcatcgctggtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttt |
279 |
Q |
| |
|
|||||||| ||||||| ||||||||||||| ||||| ||||||||||||||||||||| |||||||| | || |||||||| |||||||| ||||||| |
|
|
| T |
3220418 |
cgatggttgctgcatcaatggtttttgcactaatggtgtctgcatcgatggtttttgcaacgatggttttttcatcgatggttgctgcatcgatggtttt |
3220517 |
T |
 |
| Q |
280 |
tgcactgatggtttctgcatcgatggtttttgcac |
314 |
Q |
| |
|
|||||| ||||||||| |||||||||||||||||| |
|
|
| T |
3220518 |
tgcactaatggtttcttcatcgatggtttttgcac |
3220552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 95 - 315
Target Start/End: Original strand, 3220303 - 3220523
Alignment:
| Q |
95 |
gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat |
194 |
Q |
| |
|
|||||||||| |||||||| |||| | ||||||| |||| | |||| | |||| |||||||| |||| | |||||| ||||| |||||||||||||| |
|
|
| T |
3220303 |
gtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttctgcatcgttggtttttgcactgatggtttctgcat |
3220402 |
T |
 |
| Q |
195 |
cgctggtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttc |
294 |
Q |
| |
|
|| |||||||||||| ||||||| ||||||| |||||||||||||| ||||| | |||| ||||||||| |||| || |||||||| || ||||||| | |
|
|
| T |
3220403 |
cgatggtttttgcaccgatggttgctgcatcaatggtttttgcactaatggtgtctgcatcgatggtttttgcaacgatggttttttcatcgatggttgc |
3220502 |
T |
 |
| Q |
295 |
tgcatcgatggtttttgcact |
315 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
3220503 |
tgcatcgatggtttttgcact |
3220523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 95 - 310
Target Start/End: Original strand, 3220273 - 3220488
Alignment:
| Q |
95 |
gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat |
194 |
Q |
| |
|
||||||||||| ||||| | |||||| ||||||||||||| ||||| | |||| ||||||||| |||| | |||||| ||||| |||||||||||||| |
|
|
| T |
3220273 |
gtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttctgcat |
3220372 |
T |
 |
| Q |
195 |
cgctggtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttc |
294 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||| ||||||| |||| | ||||||| |||| |||| | |||| |||||||| |
|
|
| T |
3220373 |
cgttggtttttgcactgatggtttctgcatcgatggtttttgcaccgatggttgctgcatcaatggtttttgcactaatggtgtctgcatcgatggtttt |
3220472 |
T |
 |
| Q |
295 |
tgcatcgatggttttt |
310 |
Q |
| |
|
|||| ||||||||||| |
|
|
| T |
3220473 |
tgcaacgatggttttt |
3220488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 95 - 306
Target Start/End: Original strand, 3220378 - 3220589
Alignment:
| Q |
95 |
gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat |
194 |
Q |
| |
|
|||||||||| |||||||| |||||| |||||||||||||| ||||| ||||||| |||||||||||||| ||||| | |||| ||||||||| |||| |
|
|
| T |
3220378 |
gtttttgcactgatggtttctgcatcgatggtttttgcaccgatggttgctgcatcaatggtttttgcactaatggtgtctgcatcgatggtttttgcaa |
3220477 |
T |
 |
| Q |
195 |
cgctggtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttc |
294 |
Q |
| |
|
|| |||||||| || ||||||| |||||||||||||||||||||| ||||||| | || ||||||||| |||| |||||||| |||| ||||||| |
|
|
| T |
3220478 |
cgatggttttttcatcgatggttgctgcatcgatggtttttgcactaatggtttcttcatcgatggtttttgcaccgctggttgctgcatcaatggtttt |
3220577 |
T |
 |
| Q |
295 |
tgcatcgatggt |
306 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
3220578 |
tgcaccgatggt |
3220589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 100 - 291
Target Start/End: Original strand, 3220458 - 3220649
Alignment:
| Q |
100 |
tgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctg |
199 |
Q |
| |
|
|||| |||||||||||||| | ||||||||| || | ||||| |||||||||||||||||||||| ||||||| | || ||||||||| |||| ||||| |
|
|
| T |
3220458 |
tgcatcgatggtttttgcaacgatggttttttcatcgatggttgctgcatcgatggtttttgcactaatggtttcttcatcgatggtttttgcaccgctg |
3220557 |
T |
 |
| Q |
200 |
gtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggt |
291 |
Q |
| |
|
||| |||| ||||||| |||| ||||||| | |||| |||||||| ||||||||||||| |||||||| |||||||||||| |||||| |
|
|
| T |
3220558 |
gttgctgcatcaatggtttttgcaccgatggtgtctgcatcgatggtttttgcaccgatggttgctgcatcgatggtttttgcaccgatggt |
3220649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 95 - 306
Target Start/End: Original strand, 3220438 - 3220649
Alignment:
| Q |
95 |
gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat |
194 |
Q |
| |
|
|||||||||| ||||| | |||||| |||||||||||| | ||||| | | ||||||||||| |||| |||||||| ||||| ||||||||| ||| |
|
|
| T |
3220438 |
gtttttgcactaatggtgtctgcatcgatggtttttgcaacgatggttttttcatcgatggttgctgcatcgatggtttttgcactaatggtttcttcat |
3220537 |
T |
 |
| Q |
195 |
cgctggtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttc |
294 |
Q |
| |
|
|| |||||||||||| | ||||| ||||||| ||||||||||||| |||||| | |||| ||||||||| |||| || ||||| |||| |||||||| |
|
|
| T |
3220538 |
cgatggtttttgcaccgctggttgctgcatcaatggtttttgcaccgatggtgtctgcatcgatggtttttgcaccgatggttgctgcatcgatggtttt |
3220637 |
T |
 |
| Q |
295 |
tgcatcgatggt |
306 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
3220638 |
tgcaccgatggt |
3220649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 95 - 314
Target Start/End: Original strand, 3220363 - 3220582
Alignment:
| Q |
95 |
gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat |
194 |
Q |
| |
|
|||| |||| || ||||||||||| ||||||| |||| | ||||| | |||| |||||||| |||| ||||||| ||||| ||||| ||||||| |
|
|
| T |
3220363 |
gtttctgcatcgttggtttttgcactgatggtttctgcatcgatggtttttgcaccgatggttgctgcatcaatggtttttgcactaatggtgtctgcat |
3220462 |
T |
 |
| Q |
195 |
cgctggtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttc |
294 |
Q |
| |
|
|| ||||||||||| |||||||| | ||||||||||| |||| |||||||| ||||| ||||||||| ||||| |||||||||||| | ||||| | |
|
|
| T |
3220463 |
cgatggtttttgcaacgatggttttttcatcgatggttgctgcatcgatggtttttgcactaatggtttcttcatcgatggtttttgcaccgctggttgc |
3220562 |
T |
 |
| Q |
295 |
tgcatcgatggtttttgcac |
314 |
Q |
| |
|
|||||| ||||||||||||| |
|
|
| T |
3220563 |
tgcatcaatggtttttgcac |
3220582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 95 - 145
Target Start/End: Original strand, 3220603 - 3220653
Alignment:
| Q |
95 |
gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtct |
145 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||| ||||||||| |
|
|
| T |
3220603 |
gtttttgcaccgatggttgctgcatcgatggtttttgcaccgatggtgtct |
3220653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University