View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0380_low_12 (Length: 315)

Name: NF0380_low_12
Description: NF0380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0380_low_12
NF0380_low_12
[»] chr6 (12 HSPs)
chr6 (95-277)||(3220243-3220425)
chr6 (113-315)||(3220186-3220388)
chr6 (95-314)||(3220198-3220417)
chr6 (95-314)||(3220408-3220642)
chr6 (95-314)||(3220318-3220552)
chr6 (95-315)||(3220303-3220523)
chr6 (95-310)||(3220273-3220488)
chr6 (95-306)||(3220378-3220589)
chr6 (100-291)||(3220458-3220649)
chr6 (95-306)||(3220438-3220649)
chr6 (95-314)||(3220363-3220582)
chr6 (95-145)||(3220603-3220653)


Alignment Details
Target: chr6 (Bit Score: 159; Significance: 1e-84; HSPs: 12)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 159; E-Value: 1e-84
Query Start/End: Original strand, 95 - 277
Target Start/End: Original strand, 3220243 - 3220425
Alignment:
95 gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat 194  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3220243 gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat 3220342  T
195 cgctggtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtt 277  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| ||||||||| |||| || |||||    
3220343 cgctggtttttgcactgatggtttctgcatcgttggtttttgcactgatggtttctgcatcgatggtttttgcaccgatggtt 3220425  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 113 - 315
Target Start/End: Original strand, 3220186 - 3220388
Alignment:
113 tttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactga 212  Q
    |||||||| ||||||| |||| | ||||| | |||| | ||||||| ||||  |||||||| |||||||||||||| ||||||  ||||||||||||  |    
3220186 tttgcatcgatggtttatgcatcgatggtttttgcaccaatggtttatgcatcgatggtttttgcaccgatggtttttgcatcaatggtttttgcaccaa 3220285  T
213 tggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttctgcatcgatggtttttgc 312  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
3220286 tggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttctgcatcgttggtttttgc 3220385  T
313 act 315  Q
    |||    
3220386 act 3220388  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 95 - 314
Target Start/End: Original strand, 3220198 - 3220417
Alignment:
95 gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat 194  Q
    |||| |||| |||||||||||||| ||||||||| |||| | ||||| | |||| ||||||||||||||   ||||||| |||||| ||||| |||||||    
3220198 gtttatgcatcgatggtttttgcaccaatggtttatgcatcgatggtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcat 3220297  T
195 cgctggtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttc 294  Q
    || ||||||||||||||||||||| |||| ||||||||| ||||  | |||||| ||||| |||||||||||||||| ||||||||||||||||||||||    
3220298 cgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttctgcatcgttggtttttgcactgatggtttc 3220397  T
295 tgcatcgatggtttttgcac 314  Q
    ||||||||||||||||||||    
3220398 tgcatcgatggtttttgcac 3220417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #4
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 95 - 314
Target Start/End: Original strand, 3220408 - 3220642
Alignment:
95 gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat 194  Q
    ||||||||||||||||||  |||||||||||||||||||| ||||||||||||||||||||||||||||  |||||||| | || |||||||| ||||||    
3220408 gtttttgcaccgatggttgctgcatcaatggtttttgcactaatggtgtctgcatcgatggtttttgcaacgatggttttttcatcgatggttgctgcat 3220507  T
195 cgctggtttttgcactgatggtttctgcatcgatggtttttgcactg---------------atggtttatgcaccgatggtttctgcatcgctggtttt 279  Q
    || ||||||||||||| ||||||||| |||||||||||||||||| |               ||||||| |||||||||||| ||||||||| |||||||    
3220508 cgatggtttttgcactaatggtttcttcatcgatggtttttgcaccgctggttgctgcatcaatggtttttgcaccgatggtgtctgcatcgatggtttt 3220607  T
280 tgcactgatggtttctgcatcgatggtttttgcac 314  Q
    ||||| ||||||| |||||||||||||||||||||    
3220608 tgcaccgatggttgctgcatcgatggtttttgcac 3220642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #5
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 95 - 314
Target Start/End: Original strand, 3220318 - 3220552
Alignment:
95 gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgca---------------c 179  Q
    |||| |||||||||||||| ||||||  ||||||||||||  ||||| ||||||||| ||||||||||||||||||||| ||||               |    
3220318 gtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttctgcatcgttggtttttgcactgatggtttctgcatcgatggtttttgcac 3220417  T
180 cgatggtttctgcatcgctggtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttt 279  Q
    |||||||| |||||||  ||||||||||||| ||||| |||||||||||||||||||||  |||||||| | || |||||||| |||||||| |||||||    
3220418 cgatggttgctgcatcaatggtttttgcactaatggtgtctgcatcgatggtttttgcaacgatggttttttcatcgatggttgctgcatcgatggtttt 3220517  T
280 tgcactgatggtttctgcatcgatggtttttgcac 314  Q
    |||||| ||||||||| ||||||||||||||||||    
3220518 tgcactaatggtttcttcatcgatggtttttgcac 3220552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #6
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 95 - 315
Target Start/End: Original strand, 3220303 - 3220523
Alignment:
95 gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat 194  Q
    |||||||||| |||||||| |||| | ||||||| |||| |  |||| | ||||  |||||||| ||||  | |||||| ||||| ||||||||||||||    
3220303 gtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttctgcatcgttggtttttgcactgatggtttctgcat 3220402  T
195 cgctggtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttc 294  Q
    || |||||||||||| ||||||| ||||||| |||||||||||||| ||||| | |||| ||||||||| |||| || |||||||| ||  ||||||| |    
3220403 cgatggtttttgcaccgatggttgctgcatcaatggtttttgcactaatggtgtctgcatcgatggtttttgcaacgatggttttttcatcgatggttgc 3220502  T
295 tgcatcgatggtttttgcact 315  Q
    |||||||||||||||||||||    
3220503 tgcatcgatggtttttgcact 3220523  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #7
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 95 - 310
Target Start/End: Original strand, 3220273 - 3220488
Alignment:
95 gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat 194  Q
    ||||||||||| ||||| | |||||| |||||||||||||  ||||| | |||| ||||||||| ||||  | |||||| ||||| ||||||||||||||    
3220273 gtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttctgcat 3220372  T
195 cgctggtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttc 294  Q
    || |||||||||||||||||||||||||||||||||||||||||| |||||||  |||| | ||||||| ||||    |||| | ||||  ||||||||     
3220373 cgttggtttttgcactgatggtttctgcatcgatggtttttgcaccgatggttgctgcatcaatggtttttgcactaatggtgtctgcatcgatggtttt 3220472  T
295 tgcatcgatggttttt 310  Q
    |||| |||||||||||    
3220473 tgcaacgatggttttt 3220488  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #8
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 95 - 306
Target Start/End: Original strand, 3220378 - 3220589
Alignment:
95 gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat 194  Q
    |||||||||| |||||||| |||||| |||||||||||||| |||||  ||||||| |||||||||||||| ||||| | |||| ||||||||| ||||     
3220378 gtttttgcactgatggtttctgcatcgatggtttttgcaccgatggttgctgcatcaatggtttttgcactaatggtgtctgcatcgatggtttttgcaa 3220477  T
195 cgctggtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttc 294  Q
    || |||||||| ||  ||||||| |||||||||||||||||||||| ||||||| | || ||||||||| |||| ||||||||  ||||   |||||||     
3220478 cgatggttttttcatcgatggttgctgcatcgatggtttttgcactaatggtttcttcatcgatggtttttgcaccgctggttgctgcatcaatggtttt 3220577  T
295 tgcatcgatggt 306  Q
    |||| |||||||    
3220578 tgcaccgatggt 3220589  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #9
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 100 - 291
Target Start/End: Original strand, 3220458 - 3220649
Alignment:
100 tgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctg 199  Q
    |||| |||||||||||||| | ||||||||| || | |||||  |||||||||||||||||||||| ||||||| | || ||||||||| |||| |||||    
3220458 tgcatcgatggtttttgcaacgatggttttttcatcgatggttgctgcatcgatggtttttgcactaatggtttcttcatcgatggtttttgcaccgctg 3220557  T
200 gtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggt 291  Q
    |||  ||||   ||||||| |||| ||||||| | ||||  |||||||| ||||||||||||| |||||||| |||||||||||| ||||||    
3220558 gttgctgcatcaatggtttttgcaccgatggtgtctgcatcgatggtttttgcaccgatggttgctgcatcgatggtttttgcaccgatggt 3220649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #10
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 95 - 306
Target Start/End: Original strand, 3220438 - 3220649
Alignment:
95 gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat 194  Q
    ||||||||||  ||||| | |||||| |||||||||||| | ||||| | | |||||||||||  ||||  |||||||| |||||  ||||||||| |||    
3220438 gtttttgcactaatggtgtctgcatcgatggtttttgcaacgatggttttttcatcgatggttgctgcatcgatggtttttgcactaatggtttcttcat 3220537  T
195 cgctggtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttc 294  Q
    || |||||||||||| | ||||| ||||||| ||||||||||||| |||||| | |||| ||||||||| |||| || |||||  ||||  ||||||||     
3220538 cgatggtttttgcaccgctggttgctgcatcaatggtttttgcaccgatggtgtctgcatcgatggtttttgcaccgatggttgctgcatcgatggtttt 3220637  T
295 tgcatcgatggt 306  Q
    |||| |||||||    
3220638 tgcaccgatggt 3220649  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #11
Raw Score: 64; E-Value: 6e-28
Query Start/End: Original strand, 95 - 314
Target Start/End: Original strand, 3220363 - 3220582
Alignment:
95 gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcat 194  Q
    |||| |||| || |||||||||||   ||||||| |||| | ||||| | |||| ||||||||  ||||   ||||||| |||||  ||||| |||||||    
3220363 gtttctgcatcgttggtttttgcactgatggtttctgcatcgatggtttttgcaccgatggttgctgcatcaatggtttttgcactaatggtgtctgcat 3220462  T
195 cgctggtttttgcactgatggtttctgcatcgatggtttttgcactgatggtttatgcaccgatggtttctgcatcgctggtttttgcactgatggtttc 294  Q
    || |||||||||||  |||||||| | |||||||||||  ||||  |||||||| |||||  ||||||||| ||||| |||||||||||| | ||||| |    
3220463 cgatggtttttgcaacgatggttttttcatcgatggttgctgcatcgatggtttttgcactaatggtttcttcatcgatggtttttgcaccgctggttgc 3220562  T
295 tgcatcgatggtttttgcac 314  Q
    |||||| |||||||||||||    
3220563 tgcatcaatggtttttgcac 3220582  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #12
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 95 - 145
Target Start/End: Original strand, 3220603 - 3220653
Alignment:
95 gtttttgcaccgatggtttttgcatcaatggtttttgcaccaatggtgtct 145  Q
    ||||||||||||||||||  |||||| |||||||||||||| |||||||||    
3220603 gtttttgcaccgatggttgctgcatcgatggtttttgcaccgatggtgtct 3220653  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University