View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0380_low_22 (Length: 280)
Name: NF0380_low_22
Description: NF0380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0380_low_22 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 7e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 7e-95
Query Start/End: Original strand, 58 - 237
Target Start/End: Original strand, 4328098 - 4328277
Alignment:
Q |
58 |
catagtcccaacacgatgtagcattgatggtggtgatgctcacaatccttcacaacgacaccacctctaaacccctcttgaggtagcaaaccctgggaat |
157 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
4328098 |
catagtcccaacacgatgtagcattgatggtggtgatgctcacaatccttcacaacgacaccacctctaaacccctcttgaggtagcaaaccctgggaat |
4328197 |
T |
 |
Q |
158 |
ttctctggttgtttgatagatatgggttttggtttggatcgtgttttattcgtcgtagtcaatttgaatctcttagatct |
237 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
4328198 |
ttctctggttgtttgatagatatgggttttggtttggatcgtgttttattcgtcgtagtcaatttgagtctcttagatct |
4328277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1752 times since January 2019
Visitors: 3091