View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0380_low_23 (Length: 274)
Name: NF0380_low_23
Description: NF0380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0380_low_23 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 140; Significance: 2e-73; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 73 - 224
Target Start/End: Original strand, 46352832 - 46352983
Alignment:
| Q |
73 |
gtccattaatttagtcaaatatcctattgcacatagtaaaagcaaatagatagagataatgcttcattttttaagggatcacatgacaaaaggaaacttg |
172 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46352832 |
gtccattaatttagtccaatatcctattgcacatagtaaaagcaaatacatagagataatgcttcattttttaagggatcacatgacaaaaggaaacttg |
46352931 |
T |
|
| Q |
173 |
gtttttcagcattgtaacactaatgtgcatattgcaaattccatgaccaagt |
224 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
46352932 |
gtttttcagcattgtaatactaatgtgcatattgcaaattccatgaccaagt |
46352983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 24 - 63
Target Start/End: Original strand, 46352587 - 46352626
Alignment:
| Q |
24 |
gaggagcagagaggaaaatacaatgttcttaatggttaat |
63 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||| |
|
|
| T |
46352587 |
gaggatcaaagaggaaaatacaatgttcttaatggttaat |
46352626 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1174 times since January 2019
Visitors: 3076