View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0380_low_24 (Length: 272)
Name: NF0380_low_24
Description: NF0380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0380_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 5e-99; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 5e-99
Query Start/End: Original strand, 52 - 238
Target Start/End: Complemental strand, 5383562 - 5383376
Alignment:
| Q |
52 |
aaaacctggtccagtaagttggtcatttcagagtggaaagtttcggaaagacttcagtcttgccatgcattgtggagagaaaacttactaagttaggtat |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5383562 |
aaaacctggtccagtaagttggtcatttcagagtggaaagtttcggaaagacttcagtcttgccatgcattgtggagagaaaacttactaagttaggtat |
5383463 |
T |
 |
| Q |
152 |
taagcaatttcttatatttgtatatcctaatatttaagtggcagacaaagacccctgtgtttatttctttatacagaaattgaatct |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5383462 |
taagcaatttcttatatttgtatatcctaatatttaagtggcagacaaagacccctgcgtttatttctttatacagaaattgaatct |
5383376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University