View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0380_low_26 (Length: 259)
Name: NF0380_low_26
Description: NF0380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0380_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 36 - 241
Target Start/End: Complemental strand, 3239276 - 3239073
Alignment:
Q |
36 |
aaattaaacaaaggcttttgcatgtgtgatcaataacattccctatatcaaaagaagtttcatataatgatgagaaatggatccaaaatcaatggcttct |
135 |
Q |
|
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
T |
3239276 |
aaattgaacaaaggcttttgcatgtgtgatcaataacattccctatatcaaaagaagtttcata--atgatgagaaatggatccaaaatcaatggcttct |
3239179 |
T |
 |
Q |
136 |
ggatttgaaggaataaccatcttcctcatttcaatgtttttatagctccttcaacatcttaattctcttcaaaggtactcctattgttttatttattttt |
235 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3239178 |
ggatttgaaggaataaccatcttcctcatttcaatgtttttatagctccttcaacgtcttaattctcttcaaaggtactcctattgttttatttatttta |
3239079 |
T |
 |
Q |
236 |
tctctg |
241 |
Q |
|
|
|||||| |
|
|
T |
3239078 |
tctctg |
3239073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1031 times since January 2019
Visitors: 3074