View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0380_low_27 (Length: 259)
Name: NF0380_low_27
Description: NF0380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0380_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 75; Significance: 1e-34; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 31 - 190
Target Start/End: Complemental strand, 43460896 - 43460757
Alignment:
| Q |
31 |
tgttttcatttgcaatttactctcaaaatgtcgccgtcattgtttacggtggaagaataacgtgagagattagtatcaatgaactaagttgagttttaca |
130 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| |||||||||||||| || |
|
|
| T |
43460896 |
tgttttcatttgcaatttactctcaatatgtcgccatcattgtttacggtggaagaataacgcgagagattagtatc--------------------acg |
43460817 |
T |
|
| Q |
131 |
tgaagaattttggcatctagtttcaaaaacgttatcctatggttcacagtaaactatata |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43460816 |
cgaagaattttggcatctagtttcaaaaacgttatcctatggttcacagtaaactatata |
43460757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 182 - 232
Target Start/End: Complemental strand, 43460375 - 43460325
Alignment:
| Q |
182 |
aactatatatcttcaagtgggagtactttacattttgctatttatttattg |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
43460375 |
aactatatatcttcaagtgggagtactttacgttttgctatttatttattg |
43460325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1647 times since January 2019
Visitors: 3091