View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0380_low_31 (Length: 252)
Name: NF0380_low_31
Description: NF0380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0380_low_31 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 4 - 241
Target Start/End: Original strand, 43461006 - 43461253
Alignment:
Q |
4 |
tttagtaaagttcatcagctgcttgagttcaataaatttattacaaattcccgtatatcttacaaaaaggaattcatgcatttactgataaatggccaat |
103 |
Q |
|
|
|||||| |||||||||||||||||||| ||||||||||||||||| |||||| |||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
43461006 |
tttagtgaagttcatcagctgcttgagctcaataaatttattacacattcccatatatcttacaaaaaggaattcatgcatatactgataaatggccaat |
43461105 |
T |
 |
Q |
104 |
gctagctgtaacgtgcattattgattgcgcatttcagtgccgaaaatggt----------nnnnnnnnntaagaaatatcgtgatgatcatctattatag |
193 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
T |
43461106 |
gctagctgtaacgtgcattattgattgcgcatttcagtgccgaaaatggtaaaaaaaaaataataataataagaaatatcgtgatgatcatctattatag |
43461205 |
T |
 |
Q |
194 |
ggtgacatttcttgtctctttattagtcatatactcatattgatctct |
241 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
43461206 |
ggtgacatttcttgtctctttattagtcatatactcatattgatctct |
43461253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1478 times since January 2019
Visitors: 3088