View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0380_low_36 (Length: 229)
Name: NF0380_low_36
Description: NF0380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0380_low_36 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 201; Significance: 1e-110; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 217
Target Start/End: Complemental strand, 9848246 - 9848030
Alignment:
Q |
1 |
acaagttcagcaaccacaataaataatttaccgtactaggagccttattttaccaatgtatatcttgcaataaaataattcctatccactattgaccact |
100 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
9848246 |
acaagttcagcaaccacaataaataatttaccgtactaggagccttattttaccaatgtatatcttgcattaaaataattcctatccactattgaccact |
9848147 |
T |
 |
Q |
101 |
tctctgtccatatttcatgtcaatatctataaatcattacaacgtcggtttattctcatcgtcattttcccacaccttttaattcttgttaattgtttag |
200 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| |
|
|
T |
9848146 |
tctctgtccatatttcatgtcaatatctataaatcattacaacatcggtttattctcatcgtcattttcccactccttttaattctcgttaattgtttag |
9848047 |
T |
 |
Q |
201 |
caatatgaacttcccta |
217 |
Q |
|
|
||||||||||||||||| |
|
|
T |
9848046 |
caatatgaacttcccta |
9848030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 53 - 142
Target Start/End: Complemental strand, 9856329 - 9856240
Alignment:
Q |
53 |
ccaatgtatatcttgcaataaaataattcctatccactattgaccacttctctgtccatatttcatgtcaatatctataaatcattacaa |
142 |
Q |
|
|
|||||| |||| ||||| |||||||| |||| |||| ||||||||||||| | |||| ||||||||||||| |||||||||| |||| |
|
|
T |
9856329 |
ccaatgcatattttgcattaaaataaaccctagtcacttttgaccacttctccatacatagttcatgtcaatatatataaatcatcacaa |
9856240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1890 times since January 2019
Visitors: 3094