View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0380_low_6 (Length: 411)
Name: NF0380_low_6
Description: NF0380
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0380_low_6 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 327; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 327; E-Value: 0
Query Start/End: Original strand, 33 - 383
Target Start/End: Complemental strand, 26046007 - 26045657
Alignment:
| Q |
33 |
caaagtagagagtaaaaccctaagatggaaccgcagactggcccttcggccttcgccaattcttccatccacaagcgcaaacacctgtctgaggatcact |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
26046007 |
caaagtagagagtaaaaccctaagatggaaccgcagactggcccttcggccttcgccacttcttccatccacaagcgcaaacacctgtccgaggatcact |
26045908 |
T |
 |
| Q |
133 |
cgcctccattccacccttcttgcgactcttcgatgcacaacttcaccggttctgtcaacagtttggccactacttccggttctgtccccgactttgtggt |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26045907 |
cgcctccattccacccttcttgcgactcttcgatgcacaacttcaccggttctgtcaacagtttggccactacttccggttctgtccccgactttgtggt |
26045808 |
T |
 |
| Q |
233 |
taaggacgaagccgcaacaaatatattcactgaaaaattgcagataagaggtggttacagtgccagggaagagagtcttaagaaagaggaagaatctgga |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26045807 |
taaggacgaagccgcaacaaatatattcactgaaaacttgcagataagaggtggttacagtgccagggaagagagtcttaagaaagaggaagaatctgga |
26045708 |
T |
 |
| Q |
333 |
ttcctcaaatttgaatgcgtgtgcaatgacggtgttgatgaccatatggtt |
383 |
Q |
| |
|
|| |||||||||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26045707 |
ttactcaaatttgtatgcgtgtgcaatgatggtgttgatgaccatatggtt |
26045657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 210 - 321
Target Start/End: Original strand, 38499558 - 38499666
Alignment:
| Q |
210 |
ggttctgtccccgactttgtggttaaggacgaagccgcaacaaatatattcactgaaaaattgcagataagaggtggttacagtgccagggaagagagtc |
309 |
Q |
| |
|
|||||||| |||| | ||||||||||||| || ||| || || |||||||||||||| ||||||| || |||| ||| ||||||||||||||||||| |
|
|
| T |
38499558 |
ggttctgttcccggcattgtggttaaggagga---cgcgacgaagatattcactgaaaatttgcagactagtggtgcttatagtgccagggaagagagtc |
38499654 |
T |
 |
| Q |
310 |
ttaagaaagagg |
321 |
Q |
| |
|
| |||||||||| |
|
|
| T |
38499655 |
tcaagaaagagg |
38499666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University