View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0381_high_2 (Length: 251)

Name: NF0381_high_2
Description: NF0381
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0381_high_2
NF0381_high_2
[»] chr8 (1 HSPs)
chr8 (30-241)||(502020-502231)


Alignment Details
Target: chr8 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 30 - 241
Target Start/End: Complemental strand, 502231 - 502020
Alignment:
30 tatattcgctttatatattggtatagattaaaaataagttataagcttaatttgtgggaaaaatttgaatcaaaccgatctatctttgtaatacaacctt 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
502231 tatattcgctttatatattggtatagattaaaaataagttataagcttaatttgtgggaaaaatttgaatcaaaccgatctatctttgttatacaacctt 502132  T
130 attagcaaaaatgctagaaaactcatcttaccaaatagacccatggataatactttgtaaacacaatagaagtttcgattaatgtaactatcagagacgt 229  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
502131 attagcaaaaatgctagaaaactcatcttaccaaatagacccatggataatactttgtaaacacaatagaagtttcgattaatgtaactatcagagacgt 502032  T
230 gataaatgagta 241  Q
    ||||||||||||    
502031 gataaatgagta 502020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 1638 times since January 2019
Visitors: 3091